Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Alteromonadales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudoalteromonas atlantica T6c
Patl_2025 czcD -60 4.6 ACTCTATACTTAGTATAGACT
Glaciecola sp. HTCC2999
GHTCC_010100000540 null -78 5.2 ACCCTATACTTGGTATAGAGT
Pseudoalteromonas haloplanktis TAC125
PSHAa0576 ATW7_03852 -93 5.2 ACCTTCCAGTAACTAGAAGGT
Idiomarina baltica OS145
OS145_03978 czcD2 -61 5.5 ACCTTATAGTAGCTTTATAGT
OS145_01757 czcD -61 5.5 ACCTTATAGTAGCTTTATAGT
OS145_03758 czcD -61 5.5 ACCTTATAGTAGCTTTATAGT
Idiomarina loihiensis L2TR
IL0632 czcD2 -61 5.5 ACCTTATAGTAGCTTTATAGT
IL1242 czcD2 -61 5.5 ACCTTATAGTAGCTTTATAGT
IL1636 czcD -161 5.6 ACCTTATAGTAACTTTATAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD