Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Pasteurellales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pasteurella multocida subsp. multocida str. Pm70
PM1942 czcD -63 5.7 ACCCTGTAATGACTACGGAGT
Mannheimia succiniciproducens MBEL55E
MS1434 czcD -77 5.3 AGTCTGTAGTAGCTACGGAGT
Haemophilus somnus 2336
HSM_1740 czcD -62 5.7 ACCCTGTAATGACTACGGAGT
Haemophilus parasuis SH0165
HAPS_1831 czcD -61 5.7 ACCCTGTAATGACTACGGAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD