Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Ralstonia

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Ralstonia solanacearum GMI1000
RS05448 cadA -57 5.6 ACCCTGGAGTTCCTTCAGGGT
Ralstonia pickettii 12J
Rpic_1752 Rpic_1752 -115 6 ACCCTGTAGTCACTACAGACT
Rpic_1816 pbrR -43 6.2 ACTCTATAGCTACTATAGAGT
Rpic_1642 pbrR -43 6.2 ACTCTATAGCTACTATAGAGT
Rpic_4809 cadA -34 5.6 ACCCTGGAGCTTCTTCAGGGT
Rpic_1815 pbrA -63 6.2 ACTCTATAGTAGCTATAGAGT
Rpic_1643 pbrA -65 6.2 ACTCTATAGTAGCTATAGAGT
Ralstonia metallidurans CH34
Rmet_4594 cadA -46 6.1 ACCCTGTAGCGACTAAAGGGT
Rmet_5946 pbrR -44 6.2 ACCCTCTAGTTACTATAGAGT
Rmet_3456 cadR -30 5.9 ACCCTGTAATTACTACAGGGA
Rmet_5969 Rpic_1752 -115 6 ACCCTGTAGTCACTACAGACT
pMOL30_092 pbrR -44 6.2 ACCCTCTAGTTACTATAGAGT
Rmet_2303 pbrA -26 4.9 ACTCTATATCTACTAGAGGTT
Rmet_5947 pbrA -63 6.2 ACTCTATAGTAACTAGAGGGT
pMOL30_091 pbrA -63 6.2 ACTCTATAGTAACTAGAGGGT
Ralstonia eutropha JMP134
Reut_A3299 cadR -31 5.7 ACCCCGTAGTCACTACAGAGA
Reut_B3972 cadA -61 6.3 ACTCTGTAGCGGCTACAGGGT
Ralstonia eutropha H16
H16_A3607 cadR -42 6.1 ACCCTGTAGTAGTTACAGGGT
H16_B1644 cadA -61 6.4 ACTCTGTAGTCGCTACAGGGT
Cupriavidus taiwanensis
RALTA_A3062 cadR -39 6.1 ACCCTGTAGTCGTTACAGGGT
RALTA_B1454 cadA -61 6.4 ACTCTGTAGCCACTACAGGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD