Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Desulfovibrionales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio piger ATCC 29098
DESPIG_01843 cadA -373 5.4 ACCCTATAGCGACTATAGGCC
Desulfovibrio magneticus RS-1
DMR_12750 cadA -55 5.9 ACCCTGGAGTTGCTCCAAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD