Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Shewanellaceae

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella putrefaciens CN-32
Sputcn32_0229 czcD -59 6.4 ACTCTATAGTAACTACAGAGT
Sputcn32_1972 czcD -59 6.4 ACTCTATAGTAACTACAGAGT
Sputcn32_0195 czcD2 -61 5.6 ACCTTATAGTGACTTTATAGT
Sputcn32_0221 czcD2 -61 5.6 ACCTTATAGTGACTTTATAGT
Shewanella sp W3-18-1
Sputw3181_1169 czcD -59 6.4 ACTCTATAGTAACTACAGAGT
Sputw3181_0414 czcD2 -61 5.6 ACCTTATAGTGACTTTATAGT
Sputw3181_0520 czcD2 -61 5.6 ACCTTATAGTGACTTTATAGT
Sputw3181_0439 czcD2 -61 5.6 ACCTTATAGTGACTTTATAGT
Shewanella sp ANA-3
Shewana3_4157 czcD -57 6.3 ACTCTATAGTAACTATAGAGT
Shewanella frigidimarina NCIMB 400
Sfri_3462 cadA -61 5.8 ACTCTATAGTGACTATAGAGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD