Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MerR in Sphingomonadales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Regulog: MerR - Sphingomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Novosphingobium aromaticivorans DSM 12444
Saro_2123 grxC -36 6 ACTCCGTACCATGGTACGCAAG
Sphingopyxis alaskensis RB2256
Sala_2436 grxC -10 6.5 ACTCCGTACTATGGTACGGAGC
Sala_1624 grxC -35 6 ACTCCGTACCATGGTACGGATG
Sphingomonas wittichii RW1
Swit_1124 grxC -65 4.1 CAACCGTACCATGGTACAGCCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD