Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MerR in Rhodobacterales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Regulog: MerR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Hyphomonas neptunium ATCC 15444
HNE_1381 grxC -73 6.3 ATTCCGTACTATGGTACGGAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD