Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MerR in Various betaproteobacteria

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Regulog: MerR - Various betaproteobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Nitrosomonas europaea ATCC 19718
NE0842 merT -63 6.1 ACTCCGTACATGACTACGGAAG
Thiobacillus denitrificans
Tbd_1339 merT -52 6.2 ACTCCGTACATAACTACGGAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD