Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MerR in Comamonadaceae

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Regulog: MerR - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax sp. JS42
Ajs_1475 merT -34 6.5 ACTCCGTACTTAACTACGGAAG
Ajs_1300 merT -63 6.2 ACTCCGTAGTTGACTACGGAAG
Comamonas testosteroni KF-1
CtesDRAFT_1787 merT -63 6.3 ACTCCGTACATAACTACGGAAG
Delftia acidovorans SPH-1
Daci_0485 merT -63 6.2 ACTCCGTAGTTGACTACGGAAG
Polaromonas sp. JS666
Bpro_2231 merT -63 6.1 ACTCCGTACATTACTACGGAAA
Bpro_4797 merT -34 6.7 ACTCCGTACTTAAGTACGGAAG
Methylibium petroleiphilum PM1
Mpe_A1662 merT -57 5.6 ACTCCGTACTCAGGTACGTACC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD