Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MerR in Oceanospirillales/Alteromonadales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Regulog: MerR - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Marinobacter aqueolei
Maqu_1394 merT -65 6.1 ACTCCGTAGCTGACTACGGAAG
Maqu_4013 merT -65 6.4 ACTCCGTACTTGACTACGGAAG
Maqu_0239 merT -65 5.7 ATTCCGTAGCTGACTACGGGAG
Marinobacter sp. ELB17
MELB17_23165 merP -220 5.7 ATTCCGTAGCTGACTACGGGAG
MELB17_00680 merT -65 5.7 ATTCCGTAGCTGACTACGGGAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD