Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MerR in Psychromonadaceae/Aeromonadales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Regulog: MerR - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Psychromonas ingrahamii 37
Ping_1945 merP -358 5.7 ACTCCCTACTTGGGTACGGCAT
Aeromonas salmonicida subsp. salmonicida A449
ASA_P4G088 merT -9 6.3 ACTCCGTACATGAGTACGGAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD