Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MerR in Shewanellaceae

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Regulog: MerR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella putrefaciens CN-32
Sputcn32_0170 merT -61 6.2 ACTCCGTACTATGGTACGGCAT
Shewanella sp W3-18-1
Sputw3181_3206 merT -61 6.2 ACTCCGTACTATGGTACGGCAT
Shewanella sp ANA-3
Shewana3_4342 merT2 -63 6.3 ACTCCGTACATAACTACGGAAG
Shewana3_4314 merT -61 6.1 ACTCCGTACATCGGTACGGAGA
Shewanella frigidimarina NCIMB 400
Sfri_3491 merT -61 6 ACTCCGTACATAGGTACGGCAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD