Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Caulobacterales

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter sp. K31
Caul_2321 copZ -28 5.5 ACCTTGCCATGATGGGAAGCC
Caul_2311 cueO -42 5 TCCTTCCCATCATTGGAATCT
Caul_2317 copA -56 5.6 ACCTTCCCATGATGGGAGGGA
Phenylobacterium zucineum HLK1
PHZ_p0211 copA -59 6 ACCCTCCCATCATGGGAAGGT
PHZ_c1481 copC -129 6.1 ACCTTCCCACTATTGGAAGGT
PHZ_c1479 copZ -41 5.6 ACCCTCCCACTGTGGGAAGCT
PHZ_c1469 copA -59 5.1 ACCCTCCCATGGTGGGAAACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD