Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Sphingomonadales

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Sphingomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Novosphingobium aromaticivorans DSM 12444
Saro_2142 copA -53 5.1 ACCCTGACATGATGTCAAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD