Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Rhodospirillales

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Magnetospirillum magnetotacticum MS-1
Magn03006555 copZ2 -58 5.4 ACCTTCCCACCATGGGAACGA
Magn03006556 copA2 -127 5.1 ACCTTCCCATTGTAGGAAGCC
Magn03009759 copA -60 5.8 ACCTTCCAGTGACTGGAAGGT
Magn03009756 copZ -61 5.5 ACCTTCCATCGGCTGGAAGGT
Magnetospirillum magneticum AMB-1
amb1807 copA -26 5.9 ACCTTCCCGTTGCTGGAAGGT
amb1810 copZ -61 5.2 ACCTTCCATGGGCTGGAAGGT
Azospirillum sp. B510
AZL_a03850 copA -62 4.9 ACCTTCCAGCGGCTGGAAGCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD