Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Rhodobacterales

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodobacter sphaeroides 2.4.1
RSP_2891 copZ -123 5.3 GGCTTCCCACAACTGGAAGGT
RSP_2890 copA -48 5.3 ACCTTCCAGTTGTGGGAAGCC
Jannaschia sp. CCS1
Jann_2086 copA -54 5.5 AGCTTCCAGTCACTGGAAGGT
Rhodobacterales bacterium HTCC2654
RB2654_14810 copZ -104 5.3 CCCTTCCAGTCACTGGAAGGT
RB2654_22238 copZ -60 5.1 ACCTTCCAGCGGGGGGAAGCC
Oceanicola batsensis HTCC2597
OB2597_16487 copA -58 4.8 ACCCTCCAGTAACTGGAAGCC
OB2597_16482 copZ -60 5.1 ACCTTCCAGCGGGGGGAAGCC
Roseovarius nubinhibens ISM
ISM_17460 copZ -51 5.1 ACCTTCCCATAGGGGGACGGC
ISM_17435 copA -128 5 ACCTTCCAGTTGCTGGAAGCC
Roseovarius sp. 217
ROS217_02505 cueR -49 5.2 ACCTTCCATCTACTGGAAGGA
ROS217_07749 copA -192 4.3 ACCTTACAGTGACTGGAATCC
ROS217_03395 copA -55 5.1 ACCTTCCAGTTGGTGGAAGCC
ROS217_03390 copZ -103 5.1 GGCTTCCACCAACTGGAAGGT
ROS217_02315 copA -61 4.8 ACCTTCCAGTTACAGGAACCT
Sulfitobacter sp. EE-36
EE36_05438 copA -114 5 ACCTTCCATTAACTGGAAGCC
Silicibacter pomeroyi DSS-3
SPO0794 copA -58 4.7 ACCTTCCCGTGACTGGAACCC
Roseobacter sp. MED193
MED193_02420 copA -36 4.7 ACCTTCCGGTAACTGGAAGCC
MED193_18159 copA -62 5 ACCTTCCCCTAACTGGAGGCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD