Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Rhizobiales

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Sinorhizobium meliloti 1021
SMc02279 PF11162 -147 5 ACCTTGCCATCGTTGTAAGCC
SMb21578 copA -55 5.9 ACCTTCCCATTATTGGAAGGA
SMa1013 copA -57 5.6 ACCTTACCATTGTTGGAAGGA
SMb20560 copZ -57 5.7 ACCTTGCCATCGTTGGAAGCT
SMa1009 copZ -59 4.7 ACCTTGCCATCGTTGGAAACG
Rhizobium sp. NGR234
NGR_b08300 PF11162 -135 4.8 ACCTTACCATCGTTGGAAACA
NGR_b08430 copA -57 5.6 ACCTTACCATTGTTGGAAGGA
NGR_b12440 copA -58 5.3 ACCTTCCCACCGTTGGAAGCC
NGR_b07400 copA -58 4.5 ACCTTCCGACCGTTGTAAGCC
NGR_b08480 copZ -57 4.9 ACCCTGCCATCGTTGGAAGCC
Rhizobium leguminosarum bv. viciae 3841
pRL110010 copA -64 5.7 ACCTTCCAGTCGCTGGAAGGT
pRL110331 copA -56 5.5 ACCTTCCCATCATAGGAAGGA
Rhizobium etli CFN 42
RHE_PE00007 copA -63 5.7 ACCTTCCAGTTGCTGGAAGGT
Agrobacterium tumefaciens str. C58 (Cereon)
Atu1195 copA -54 5.4 ACCTTGCCACGATGGGAAGCC
Atu0937 copA -110 5.6 ACCTTCCCATCATGGGAAGCC
Mesorhizobium sp. BNC1
Meso_2667 copA -49 5.5 ACCTTCCAGTAACTGGAAGGA
Meso_3894 copZ -35 5.3 ACCTTCCAACGGTGGGAAGCC
Meso_3893 copA -66 5.4 ACCTTCCCATCGTTGGAAGCC
Meso_3893 copA -115 5.3 GGCTTCCCACCGTTGGAAGGT
Mesorhizobium loti MAFF303099
mlr5325 copA -62 5.2 ACCTTCCAGTTACTGGAAGCA
Brucella melitensis 16M
BMEI1730 copA -77 5.4 ACCTTCCAACGGTTGGAAGGG
BMEI1032 copZ -59 5.9 ACCTTGCCACGATGGGAAGCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD