Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Various betaproteobacteria

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Various betaproteobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thauera sp. MZ1T
Tmz1t_3243 copA -62 5.5 ACCTTCCCACGTTGGCAAGGT
Thiobacillus denitrificans
Tbd_2266 copA -59 6 ACCTTGCCATGATGGCAAGGT
Methylotenera mobilis JLW8
Mmol_1489 copZ -115 4.8 TGCTTTCCACTATTGTAAGGT
Mmol_1489 copZ -66 5.6 ACCTTACAATTGTTGGAAGCT
Mmol_1488 cueR -156 5.6 AGCTTCCAACAATTGTAAGGT
Mmol_1488 cueR -107 4.8 ACCTTACAATAGTGGAAAGCA
Mmol_1490 cusC -290 5.6 ACCTTACAATTGTTGGAAGCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD