Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Burkholderia

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia pseudomallei K96243
BPSL0301 copZ -11 5.6 ACCTTCCCACAGTGGGAAGAT
Burkholderia sp. 383
Bcep18194_A6338 copZ -64 5.8 ACCTTCCCACCGTGGCAAGCT
Burkholderia cepacia AMMD
Bamb_3036 copZ -64 5.9 ACCTTCCCACCATGGCAAGCT
Burkholderia vietnamiensis G4
Bcep1808_7262 copZ -32 5.6 ACCTTCCCATCGTTGGAACGT
Bcep1808_3075 copZ -64 5.9 ACCTTCCCACCATGGCAAGCT
Bcep1808_3973 cueR2 -26 6.3 ACCTTCCCATAGTGGGAAGGT
Bcep1808_7183 cueR2 -69 5.7 ACCTTCCCAACGTGGGAAGGT
Burkholderia xenovorans LB400
Bxe_B2298 copZ -58 5.8 ACCTTACCGCCGTGGGAAGGT
Bxe_A3162 copZ -90 6.2 ACCTTGCCATCATGGGAAGGT
Bxe_A3161 cueR -8 6.2 ACCTTCCCATGATGGCAAGGT
Burkholderia phymatum STM815
Bphy_1968 copZ -89 6.2 ACCTTCCCACTGTGGGAAGGT
Bphy_1967 cueR -64 6.2 ACCTTCCCACAGTGGGAAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD