Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Xanthomonadales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Xanthomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Stenotrophomonas maltophilia K279a
Smlt2178 copZ -61 5.6 ACCCTGCCATCGTTGGAAGGT
Smlt2176 copA -62 6.1 ACCTTCCCACGATGGCAAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD