Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Moraxellaceae

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Moraxellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acinetobacter baumannii AB0057
AB57_1352 copZ -123 5.6 AGATTCCCATCATGGGAAGGT
AB57_1353 copA -121 5.4 ACCTTGTCATGATTGTAAGGT
AB57_1353 copA -70 5.6 ACCTTCCCATGATGGGAATCT
AB57_1352 copZ -72 5.4 ACCTTACAATCATGACAAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD