Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Pseudomonadaceae

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA3523 null -89 5.1 ACCTTGCCAAGGTGTCAAGGT
PA3920 copA -97 4.9 ACCTTGACACGATGTCAAGGC
Pseudomonas entomophila L48
PSEEN0671 copZ -56 5.9 ACCTTGCCCCGATGGCAAGGT
PSEEN0669 copA -55 5.3 ACCTTGACCGCATGGCAAGGT
Pseudomonas putida KT2440
PP5393 copZ2 -71 5.2 ACCTTGTCATCGTGTCAAGGT
PP0588 copZ -56 5.3 ACCTTGTCCTGATGGCAAGCT
PP0586 copA -53 5.3 ACCTTGCCTGCGTGGCAAGGT
Pseudomonas syringae pv. tomato str. DC3000
PSPTO0752 copZ -59 6 ACCTTGCCATGATGGCAAGGT
PSPTO0750 copA -59 5.4 ACCTTGCCCATGTGGCAAGGT
Pseudomonas fluorescens Pf-5
PFL_0712 copZ -56 5.5 ACCTTGCCACGGTGGCAAGGA
PFL_0710 copA -56 5.3 ACCTTGCCTGCGTGGCAAGGT
Pseudomonas mendocina ymp
Pmen_2225 copZ -72 5.7 ACCTTGCCATCGTGTCAAGGT
Pmen_0821 copA -57 5.6 ACCTTGCCATGGGGTCAAGGT
Pmen_0823 copZ -8 5.7 ACCTTGCCATGGTGGCAAGCT
Pseudomonas stutzeri A1501
PST_3613 copA -58 5.6 ACCTTGCCATAGGGTTAAGGT
PST_3386 copZ2 -65 5.5 ACCTTGCCGCTCTGGCAAGGT
PST_2713 copZ2 -67 5.5 ACCTTGCCATGGCGTCAAGGT
PST_3612 copZ -58 5.3 ACCTTGCCAGGGTGGCAAGCT
Azotobacter vinelandii AvOP
Avin_10070 copZ -59 5.2 ACCTTGCCCGGGGGGCAAGCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD