Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Oceanospirillales/Alteromonadales

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Saccharophagus degradans 2-40
Sde_1951 copZ -75 4.6 ACCTTACCACAATGGGAGACA
Sde_1952 copA -54 5.2 ACTTTCCCACGATGGCAAGGA
Sde_1950 cueR -59 5.6 ACCTTCCTATAATGGGAGGGT
Cellvibrio japonicus Ueda107
CJA_2023 copZ -63 5.3 ACCTTACCATGATGTCAAGGA
CJA_1835 copZ -60 4.9 ACCTTGCCACCGAGGCAAGCC
CJA_1836 copA -58 6.1 ACCTTACCATGATGGGAAGGT
CJA_2024 copA -247 5.3 ACCTTACCATGATGTCAAGGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD