Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Psychromonadaceae/Aeromonadales

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Psychromonas ingrahamii 37
Ping_1340 copA -62 4.8 ACCTTACCCTAAGGGTAATGG
Ping_1381 copA2 -69 4.6 ACCTTCCCCTAAGAGTAATGA
Psychromonas sp. CNPT3
PCNPT3_11152 PCNPT3_11152 -56 4.6 ACCTTACCGTTAGGGGAGCTT
PCNPT3_05574 copA -59 4.5 ACCTTAACCTATGGGTAAGGG
Moritella sp. PE36
PE36_15789 PCNPT3_11152 -68 4.9 ACCTTCCCCTTAAGGTAAAGA
PE36_19605 copA2 -182 4.3 GGTTTACCTTAGCTGGAAGGT
PE36_19605 copA2 -97 4.8 ACCTTCCAGTTAGGGTAAAGG
PE36_15557 copA -62 4.6 ACCTTACACTAAGGGTAAAGG
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_4222 copA -70 3.8 CCCTTACAGTAAAGGTTAGGG
Aeromonas salmonicida subsp. salmonicida A449
ASA_0103 copA -75 4 AGCTTACCCTTACAGTAAAGG
ASA_0103 copA -69 3.8 CCCTTACAGTAAAGGTTAGGG
Tolumonas auensis DSM 9187
Tola_0589 copA -60 5.3 ACCTTGCCATGATGTCAAGGC
Tola_0588 copZ -56 5.9 ACCTTCCAATAGAGGGAAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD