Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Alteromonadales

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Colwellia psychrerythraea 34H
CPS_1916 copA -65 5 ACCTTACTACCGTGGTAAGCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD