Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Pasteurellales

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Haemophilus influenzae Rd KW20
HI0292 copA0 -63 5 ACCTTAACCTTATGTAAAGGT
HI0293 cueR -34 5 ACCTTTACATAAGGTTAAGGT
Aggregatibacter aphrophilus NJ8700
NT05HA_0168 copA0 -82 5.2 ACCTTAACCTAACGTTAAGGT
NT05HA_0167 cueR -33 5.2 ACCTTAACGTTAGGTTAAGGT
Pasteurella multocida subsp. multocida str. Pm70
PM1939 COG3019 -64 5 ACCTTAACCCTAGGTCAAGCT
Mannheimia succiniciproducens MBEL55E
MS0887 copA0 -68 5.8 ACCTTCCCCTTAGGTCAAGGT
MS0886 cueR -55 5.8 ACCTTGACCTAAGGGGAAGGT
Actinobacillus succinogenes 130Z
Asuc_1034 copA -28 5 ACTTTACCCTTACGTCAAGGT
Asuc_1033 cueR -63 5 ACCTTGACGTAAGGGTAAAGT
Haemophilus somnus 2336
HSM_1725 COG3019 -66 4.9 ACCTTAACCCTAGGTTAAGCT
HSM_1728 cueR -72 4.4 ACCTTGCGTTAGGGTCAAGGA
Actinobacillus pleuropneumoniae serovar 7 str. AP76
APP7_1312 cueR -35 4.8 TCCTTAACCCTAGGTTAAGGT
APP7_1313 COG3019 -71 4.8 ACCTTAACCTAGGGTTAAGGA
Haemophilus parasuis SH0165
HAPS_1832 cueR -78 4.4 AGCCTAACCTTATGTTAGGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD