Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Vibrionales

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC2215 copA -29 5.3 ACCTTACCTTAAGGTTAAGGT
VCA0262 VCA0262 -57 4.5 ACCTTCCCCTAGGGTAAAACT
Vibrio vulnificus CMCP6
VV20052 PF00034 -58 5.7 AGCTTCCCCTTAGGGGAAGCT
VV1_0239 copA -60 5.8 ACCTTCCCCCGGCGGCAAGGT
VV20849 VCA0262 -102 4.9 ACCTTACCCTAGGGTAAAGCT
Vibrio harveyi ATCC BAA-1116
VIBHAR_05667 PF00034 -64 5.7 AGCTTCCCCTAAGGGGAAGCT
VIBHAR_01268 copA -57 5.6 ACCTTCCCCTTGCAGGAAGGT
VIBHAR_06363 VCA0262 -58 5 ACCTTCCCCTAAGGTTAACCT
Vibrio parahaemolyticus RIMD 2210633
VP0758 copA -58 5.6 ACCTTCCCCTTGATGTAAGGT
VPA0484 VCA0262 -72 4.7 ACTTTCCCCCTAGGGTAACCT
VPA1012 PF00034 3 5.7 AGCTTCCCCTTAGGGGAAGCT
Vibrio shilonii AK1
VSAK1_08868 copA -100 5.7 ACCTTACCCTTGCGGTAAGGT
VSAK1_10308 VCA0262 -56 5.9 ACCTTCCCCTTAGGGGAGGGT
Vibrio splendidus LGP32
VS_II0513 VCA0262 -53 5.6 ACCTTACCCTAAGGGGAACGT
Vibrio fischeri ES114
VF_0782 cueR -46 5.5 ACCTTACAGTTAATGGAAGGT
VF_0781 copA -60 5.5 ACCTTCCATTAACTGTAAGGT
VF_A0442 VCA0262 -50 5.5 ACCTTCCCCTAAGTGGAGGCT
Vibrio salmonicida LFI1238
VSAL_I0803 cueR -47 5.5 ACCTTACAGTAAATGGAAGGT
VSAL_I0802 copA -61 5.5 ACCTTCCATTTACTGTAAGGT
VSAL_II0717 VCA0262 -59 5.4 ACCTTACCCTAAGTGGAAGGC
Vibrio angustum S14
VAS14_16476 copA -107 5.2 ACCTTACAGTAACTAGAAGGT
VAS14_16481 cueR -73 5.2 ACCTTCTAGTTACTGTAAGGT
Photobacterium profundum SS9
PBPRA2824 copA -92 4.7 ACCTTACACCAACCAGAAGGT
PBPRA1006 VCA0262 -201 5.5 ACCTTACCCTTAGGGAAAGGT
PBPRA2823 cueR -82 4.7 ACCTTCTGGTTGGTGTAAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD