Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Ralstonia

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Ralstonia solanacearum GMI1000
RS02623 copA -61 5.3 ACCTTCCTAATATGGGAAGGT
RS02624 copZ -69 4.9 CGTTTCCCATGGTGGGAAGGT
Ralstonia pickettii 12J
Rpic_4609 copA2 -156 5.3 ACCTTCCCTCCGTGGAAAGGT
Rpic_3543 copA -100 5.1 ACCTTCCCATCGTGGGAAGTG
Rpic_1651 null -116 5.7 ACGTTGCCATTGTGGGAAGGT
Rpic_3544 copZ -66 5.1 CACTTCCCACGATGGGAAGGT
Rpic_1805 cueR2 -125 4.9 ACCTTCCCACGTGGGCAGGCT
Ralstonia metallidurans CH34
Rmet_6119 copA2 -349 5.8 ACCTTCCCATGGCGGGAAGGA
Rmet_5030 cusD -110 4.6 ACGTTCCTGCCGTGGGAACGT
pMOL30_143 copA2 -349 5.8 ACCTTCCCATGGCGGGAAGGA
Rmet_3524 copA -67 5.9 ACCTTCCAATGGTGGTAAGGT
Ralstonia eutropha JMP134
Reut_A3377 copZ -82 5.5 CGCTTCCCACCATGGGAAGGT
Reut_A3376 copA -59 5.6 ACCTTCCTATGATGGTAAGGT
Ralstonia eutropha H16
H16_A2173 copA2 -358 5.4 ACCTTCCAACGATGGGAACCT
H16_A3668 copA -61 6 ACCTTCCAATGATGGTAAGGT
H16_A3669 copZ -81 5.5 CGCTTCCCACCATGGGAAGGT
Cupriavidus taiwanensis
RALTA_A3125 copZ -80 5.3 CGCTTCCCATGGTGGCAAGGT
RALTA_A3123 copA -60 6 ACCTTCCAATGATGGTAAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD