Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ZntR in Sphingomonadales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Regulog: ZntR - Sphingomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Sphingopyxis alaskensis RB2256
Sala_2470 zntR -41 4.7 ACCTTGGACCATGGTCCAACCT
Sphingobium japonicum UT26S
SJA_C1-05190 zntR -41 4.1 ACCCTGGACCATGGTCCAACCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD