Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Rhodospirillales

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azospirillum sp. B510
AZL_b04530 mntR 16 3.7 AGTATGCAAGGCGCTATACT
AZL_b04520 mntH -114 3.7 AGTATAGCGCCTTGCATACT
Gluconacetobacter diazotrophicus PAl 5
Gdia_1353 mntR -179 5.1 AATATGCAATAAGCTATATG
Gdia_1352 mntH 16 5.1 CATATAGCTTATTGCATATT
Acetobacter pasteurianus IFO 3283-01
APA01_40860 mntR -157 5.7 AATATGCAATATGCTATATT
APA01_40860 mntR -64 5.6 TTTATTCTTTATGGAATATT
APA01_40840 mntH -141 5.6 AATATTCCATAAAGAATAAA
APA01_40840 mntH -48 5.7 AATATAGCATATTGCATATT
Gluconobacter oxydans 621H
GOX2068 mntR -140 5.6 AATATTCAACATGCTATATT
GOX2068 mntR -49 4.6 TTTATTCCGCCGTGAATAAT
GOX2067 mntH -28 5.6 AATATAGCATGTTGAATATT
GOX2067 mntH -119 4.6 ATTATTCACGGCGGAATAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD