Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Rhodobacterales

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodobacterales bacterium HTCC2654
RB2654_12814 COG2132 -98 4.6 GGAGTTAAAAGATGCTGACTCG
RB2654_22338 mntR -77 6.5 AAAGTTAGACATGGCTAACTTA
Roseovarius nubinhibens ISM
ISM_17630 mntR -70 5.4 AAAGTTAGCTTCGGCTAATAAT
ISM_17635 COG2132 -278 5.4 ATTATTAGCCGAAGCTAACTTT
Roseovarius sp. 217
ROS217_03050 mntR -77 6.3 AAAGTTAGACATGGCTAATTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD