Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Rhizobiales

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhizobium sp. NGR234
NGR_b14390 mntR -141 6.2 AATATAGCAAGTGCTATAAT
NGR_b14390 mntR -61 5.8 AAAATAGCCTTAGCTATATT
NGR_b14380 COG2132 -153 5.8 AATATAGCTAAGGCTATTTT
NGR_b14380 COG2132 -73 6.2 ATTATAGCACTTGCTATATT
Mesorhizobium sp. BNC1
Meso_4423 mntR -46 5.1 TCCATAGCCGAGGCTATAAT
Meso_4423 mntR -109 5.8 ATTATAGCAAATGCTATTTC
Meso_4422 COG2132 -73 5.8 GAAATAGCATTTGCTATAAT
Meso_4422 COG2132 -136 5.1 ATTATAGCCTCGGCTATGGA
Mesorhizobium loti MAFF303099
mlr2501 mntH -195 5.2 TTTATAGCACGGGCTCTGAT
mll2499 mntR -55 5.2 ATCAGAGCCCGTGCTATAAA
Bradyrhizobium sp. BTAi1
BBta_1556 mntH -92 5.4 AATGTAGCAGAAGCTATATC
BBta_1555 mntR -127 5.4 GATATAGCTTCTGCTACATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD