Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Xanthomonadales

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Xanthomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Xylella fastidiosa 9a5c
XF1015 mntH 9 5.6 GGTATAGCCAATGCTATAAG
XF1013 mntR -193 5.6 CTTATAGCATTGGCTATACC
Xanthomonas axonopodis pv. citri str. 306
XAC2036 mntH -49 6.2 AGCATAGCAACTGCTATATC
XAC2037 mntR -113 6.2 GATATAGCAGTTGCTATGCT
Xanthomonas campestris pv. campestris str. ATCC 33913
XCC2171 mntH -50 6.2 AGCATAGCACTTGCTATATC
XCC2170 mntR -113 6.2 GATATAGCAAGTGCTATGCT
Stenotrophomonas maltophilia K279a
Smlt2837 mntR -110 5.9 AATATAGCTCCTGCTATAGT
Smlt2838 mntH -27 5.9 ACTATAGCAGGAGCTATATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD