Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Rhodospirillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azospirillum sp. B510
AZL_d00380 gntK -138 5.6 CAAGGTTAGCGCTAACAGTA
AZL_d00380 gntK -48 6.1 TCATGATAGCGCTAACATAA
AZL_a08610 gntR -114 6.2 CGATGTAAGCGCTTACATAG
AZL_a08610 gntR -47 5.5 ATATGTAACCGCTTTCAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD