Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Rhizobiales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Xanthobacter autotrophicus Py2
Xaut_1235 gntK -204 5.8 ATAAGATAACGCTATCTTGA
Xaut_1234 gntT -124 6.6 GCGAGATAGCGCTATCTCAC
Xaut_1236 gntR -161 6.3 CTGAGATAGCGCTGTCTTTC
Xaut_1235 gntK -61 6.3 GAAAGACAGCGCTATCTCAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD