Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Various betaproteobacteria

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Various betaproteobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chromobacterium violaceum ATCC 12472
CV2957 gntK -20 6.7 TTTTGTTAGCGCTAACATCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD