Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Comamonadaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_2797 gntK -109 6.1 CTAGGATAGCGCTATCTTGC
Aave_2798 gntR -55 6.1 GCAAGATAGCGCTATCCTAG
Aave_2798 gntR -172 6.1 CTTGGATAGCGCTATCCGTT
Acidovorax sp. JS42
Ajs_2054 gntR -55 6 GAAAGATAGCGCTATCTTAA
Ajs_2054 gntR -219 6 TCAAGATAGCGCTATCTTTA
Ajs_2053 gntK -180 6 TTAAGATAGCGCTATCTTTC
Comamonas testosteroni KF-1
CtesDRAFT_0562 gntR -181 6.3 TTTGGATAGCGCTATCCGAT
CtesDRAFT_0562 gntR -55 6 TCCGGATAGCGCTATCATAA
CtesDRAFT_0561 gntK -21 6.3 ATCGGATAGCGCTATCCAAA
CtesDRAFT_0561 gntK -147 6 TTATGATAGCGCTATCCGGA
Delftia acidovorans SPH-1
Daci_3761 gntK -120 6.3 TTATGATAGCGCTATCCCAA
Daci_3760 gntR -175 6.2 TTGGGATAGCGCTATCCATG
Daci_3760 gntR -56 6.3 TTGGGATAGCGCTATCATAA
Polaromonas naphthalenivorans CJ2
Pnap_0047 gntR -128 6.1 CTTGGATAGCGCTATCCGTT
Pnap_0046 gntK -140 6.5 ATAGGATAGCGCTATCCCAA
Pnap_0046 gntK -30 6.1 AACGGATAGCGCTATCCAAG
Rhodoferax ferrireducens DSM 15236
Rfer_0956 gntK -33 6.1 TTAAGATAGCGCTATCTATT
Rfer_0957 gntR -197 6.1 AATAGATAGCGCTATCTTAA
Variovorax paradoxus S110
Vapar_6142 gntT -66 5.8 GCGGGATAGCGCTATCCCTG
Vapar_6142 gntT -141 6.1 CTAGGATAGCGCTGTCCCAG
Vapar_6141 gntR -70 6.1 CTGGGACAGCGCTATCCTAG
Vapar_6141 gntR -54 5.7 CTAGGACAGCGCTGTCCAAT
Vapar_6141 gntR -145 5.8 CAGGGATAGCGCTATCCCGC
Vapar_6142 gntT -157 5.7 ATTGGACAGCGCTGTCCTAG
Leptothrix cholodnii SP-6
Lcho_0327 gntK -128 6.6 CTAGGATAGCGCTATCCAAA
Lcho_0327 gntK -19 6 ACGAGATAGCGCTATCCAAA
Lcho_0328 gntR -170 6 TTTGGATAGCGCTATCTCGT
Lcho_0328 gntR -61 6.6 TTTGGATAGCGCTATCCTAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD