Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Burkholderia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia phymatum STM815
Bphy_5548 gntK -35 6.7 CTGAGACAGCGCTGTCTCGG
Bphy_5548 gntK -137 6.2 TTAGGATAGCGCTGTCTCAA
Bphy_5547 gntR -27 6.2 TTGAGACAGCGCTATCCTAA
Bphy_5547 gntR -129 6.7 CCGAGACAGCGCTGTCTCAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD