Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Pseudomonadaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA2321 gntK -34 6 CAAAGATAGCGCTGTCTCAC
PA2321 gntK -162 5.9 CTAAGGTAGCGCTGTCTCGC
PA2320 gntR -52 5.9 GCGAGACAGCGCTACCTTAG
PA2322 gntT -78 5.5 CAAAGATAGCGCTACCCCGA
PA2320 gntR -180 6 GTGAGACAGCGCTATCTTTG
Pseudomonas entomophila L48
PSEEN2421 gntK -166 6 CTAAGGTAGCGCTGTCTCAG
PSEEN2421 gntK -36 6 CCAAGACAGCGCTATCTCAC
PSEEN2422 gntR -192 6 GTGAGATAGCGCTGTCTTGG
PSEEN2422 gntR -62 6 CTGAGACAGCGCTACCTTAG
PSEEN2420 gntT -82 6 CAAAGACAGCGCTGTCTTAA
Pseudomonas putida KT2440
PP3415 gntR -191 5.9 GTGAGATAGCGCTGTCTCGC
PP3415 gntR -62 6 CTGAGACAGCGCTACCTTAG
PP3416 gntK -164 6 CTAAGGTAGCGCTGTCTCAG
PP3416 gntK -35 5.9 GCGAGACAGCGCTATCTCAC
PP3417 gntT -88 5.5 CAAAGACAGCGCTACCCCAA
Pseudomonas syringae pv. tomato str. DC3000
PSPTO3564 gntK -238 5.7 ATAAGGTAGCGCTGTCTCAT
PSPTO3564 gntK -74 5.8 CAAAGACAGCGCTGTCTCCA
PSPTO3565 gntT -82 5.9 AAAAGACAGCGCTGTCTTGC
PSPTO3563 gntR -229 5.8 TGGAGACAGCGCTGTCTTTG
PSPTO3563 gntR -65 5.7 ATGAGACAGCGCTACCTTAT
Pseudomonas fluorescens Pf-5
PFL_4580 gntK -185 5.6 CTAAGGTAGCGCTGTCCTGA
PFL_4580 gntK -34 5.5 CGAAGGTAGCGCTGTCTGCG
PFL_4581 gntR -201 5.5 CGCAGACAGCGCTACCTTCG
PFL_4581 gntR -50 5.6 TCAGGACAGCGCTACCTTAG
PFL_4579 gntT -72 5.5 AAAAGGTAGCGCTATCCCAC
Pseudomonas mendocina ymp
Pmen_2569 gntKZ -67 4.5 TTTGGATAGCGCTAACATCC
Pseudomonas stutzeri A1501
PST_2201 gntKZ -104 4.5 GTTTGATAGCGCTAACATCC
Azotobacter vinelandii AvOP
Avin_27300 gntR -167 5.5 CGAGGACAGCGCTATCCTGT
Avin_27310 gntK -177 5.5 ACAGGATAGCGCTGTCCTCG
Avin_22480 gntK -30 5.5 AAAAGATAGCGCTATCTACC
Avin_22480 gntK -176 5.9 ATAAGATAGCGCTGTCTTTA
Avin_22470 gntT -57 5.9 GAAAGATAGCGCTGTCTCGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD