Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Oceanospirillales/Alteromonadales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Hahella chejuensis KCTC 2396
HCH_03539 gntX -129 5.6 AAAAGTTACCGGTAACAAAT
HCH_03539 gntX -103 6 GAATGTTACCGGTAACACGC
Marinomonas sp. MWYL1
Mmwyl1_0698 gntX -123 5.6 AAATGTTATCGGTAACATCA
Mmwyl1_0698 gntX -100 5.7 TCTAGTTACCGGTAACATTT
Chromohalobacter salexigens DSM 3043
Csal_0926 gntK -69 4.5 AGGCGCGACCGGCAACGAGG
Csal_0927 gntR -53 5.6 GAACGTTACCGCTAACATCG
Csal_0925 gntU -107 6.3 GAATGTTACCGGTAACATTC
Csal_0925 gntU -40 4.5 CCTCGTTGCCGGTCGCGCCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD