Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Psychromonadaceae/Aeromonadales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Psychromonas ingrahamii 37
Ping_2932 gntK -64 5.6 ATATGTTACCCGTAACTTAG
Ping_2929 gntR -21 6.1 TTATGTTACAGGTAACATTT
Ping_2933 gntX -98 6 GTAAGTTACCGGTAACATTC
Ping_2933 gntX -76 5.2 ATCAGTTACCGGTAACCTAT
Ping_2932 gntK -78 5 TCAAGTTACGGCTAATATGT
Moritella sp. PE36
PE36_03034 gnd -109 4.7 TAACGATAGCGTTAACATTG
PE36_03014 gntX -67 5.9 AATAGTTACCGGTAACATAA
PE36_03024 gntK -83 5.2 CTGTGTTAACGGTAACATTG
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_0287 gntK -89 6.2 TGTTGTTACCGGTAACATGT
AHA_0287 gntK -75 6.4 ACATGTTACCGGTAACGTGC
AHA_0290 gntR -35 5.8 TAATGTTACGTGTAACATTT
AHA_0286 gntT -190 6.4 GCACGTTACCGGTAACATGT
AHA_0286 gntT -176 6.2 ACATGTTACCGGTAACAACA
Aeromonas salmonicida subsp. salmonicida A449
ASA_4110 gntK -89 6.2 TGTTGTTACCGGTAACATGT
ASA_4110 gntK -75 5.9 ACATGTTGCCGGTAACGTGC
ASA_4111 gntT -190 5.9 GCACGTTACCGGCAACATGT
ASA_4111 gntT -176 6.2 ACATGTTACCGGTAACAACA
ASA_4107 gntR -35 5.7 TAATGTTACGTGTAACATTC
Tolumonas auensis DSM 9187
Tola_0778 gntK -76 6.2 ACATGATACCGGTAACATGC
Tola_0778 gntK -90 6.4 ACTTGTTACCGGTAACATGA
Tola_0779 gntT -176 6.4 TCATGTTACCGGTAACAAGT
Tola_0779 gntT -190 6.2 GCATGTTACCGGTATCATGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD