Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Alteromonadales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudoalteromonas haloplanktis TAC125
PSHAb0479 gntU -83 6.6 ACATGTTACGCGTAACTTAA
PSHAb0478 gntR -97 6.5 TTATGTTACGTGTAACATAA
PSHAb0480 gntK -90 6.6 TTAAGTTACGCGTAACATGT
PSHAb0480 gntK -76 6.3 ACATGTTACCAGTAACTTAA
PSHAb0479 gntU -97 6.3 TTAAGTTACTGGTAACATGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD