Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Pasteurellales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Aggregatibacter aphrophilus NJ8700
NT05HA_1087 gntU -171 5.9 AAATGTTATCGGTAACAATC
NT05HA_1087 gntU -40 6.2 GTATGTTACCAGTAACATTT
NT05HA_1088 gntK -195 6.2 AAATGTTACTGGTAACATAC
NT05HA_1088 gntK -64 5.9 GATTGTTACCGATAACATTT
Pasteurella multocida subsp. multocida str. Pm70
PM0793 gntU -202 5.6 AAACGTTACTGGTAACATCA
PM0793 gntU -40 6.2 TTATGTTACTGGTAACAATA
PM0792 gntK -232 6.2 TATTGTTACCAGTAACATAA
PM0792 gntK -70 5.6 TGATGTTACCAGTAACGTTT
Mannheimia succiniciproducens MBEL55E
MS0956 idnD -167 5.5 AACAGTTACCGATAACAATA
MS0956 idnD -36 5.6 GTATGTTACCAGTAACCAAT
MS0957 gntK -201 5.6 ATTGGTTACTGGTAACATAC
MS0957 gntK -70 5.5 TATTGTTATCGGTAACTGTT
Actinobacillus succinogenes 130Z
Asuc_1155 idnD -36 6.1 ATATGTTACTGGTAACAATC
Asuc_1154 gntK -209 6.1 GATTGTTACCAGTAACATAT
Asuc_1154 gntK -67 6.2 AAATGTTACTGGTAACAGAT
Asuc_1155 idnD -178 6.2 ATCTGTTACCAGTAACATTT
Haemophilus somnus 2336
HSM_0703 idnD -189 5.3 AAAAGTTACCAATAACACTT
HSM_0703 idnD -37 6.1 ATATGTTACCAGTAACAGAA
HSM_0704 gntK -227 6.1 TTCTGTTACTGGTAACATAT
HSM_0704 gntK -75 5.3 AAGTGTTATTGGTAACTTTT
Actinobacillus pleuropneumoniae serovar 7 str. AP76
APP7_1726 gntK -155 6.2 AATTGTTACTGGTAACATAA
APP7_1726 gntK -66 6 TAATGTTACCTGTAACATTA
APP7_1725 gntU -131 6 TAATGTTACAGGTAACATTA
APP7_1725 gntU -42 6.2 TTATGTTACCAGTAACAATT
Haemophilus parasuis SH0165
HAPS_1788 gntK -179 6.3 AATTGTTACTGGTAACATAT
HAPS_1788 gntK -40 5.6 TTCAGTTATCGGTAACATTT
HAPS_1787 gntU -38 6.3 ATATGTTACCAGTAACAATT
HAPS_1787 gntU -177 5.6 AAATGTTACCGATAACTGAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD