Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Vibrionales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC0286 gntU -80 6.2 TCATGTTATGGGTAACATGT
VC0286 gntU -66 6.2 ACATGTTACCGGTAACTTCA
VC0289 gntR -40 5.7 TAATGTTACTCATAACATTT
VC0287 gntK -93 6.2 ACATGTTACCCATAACATGA
VC0287 gntK -107 6.2 TGAAGTTACCGGTAACATGT
Vibrio vulnificus CMCP6
VV1_1101 gntU -79 6.5 TCATGTTATCGGTAACATGT
VV1_1101 gntU -65 6.1 ACATGTTACCGGTAACGTAA
VV1_1098 gntR -37 5.7 TAATGTTACAAGTAACATTA
VV1_1100 gntK -107 6.1 TTACGTTACCGGTAACATGT
VV1_1100 gntK -93 6.5 ACATGTTACCGATAACATGA
Vibrio harveyi ATCC BAA-1116
VIBHAR_00513 gntK -106 5.9 TTTAGTTACCGGTAACATGT
VIBHAR_00513 gntK -92 6.5 ACATGTTACCGATAACATGA
VIBHAR_00514 gntU -80 6.5 TCATGTTATCGGTAACATGT
VIBHAR_00514 gntU -66 5.9 ACATGTTACCGGTAACTAAA
VIBHAR_00507 gntR -38 5.9 TAATGTTACTAGTAACATTA
Vibrio parahaemolyticus RIMD 2210633
VP0063 gntK -107 5.9 TTCAGTTACCGGTAACATGT
VP0063 gntK -93 6.5 ACATGTTACCGATAACATGA
VP0064 gntU -80 6.5 TCATGTTATCGGTAACATGT
VP0064 gntU -66 5.9 ACATGTTACCGGTAACTGAA
Vibrio shilonii AK1
VSAK1_19439 gntK -129 5.9 AAAAGTTACCGGTATCATGT
VSAK1_19439 gntK -115 5.9 TCATGTTACCAGTAACATCG
Vibrio splendidus LGP32
VS_II0405 gntX -85 5.5 TAAAGTTACCGGTAACATCC
VS_II0405 gntX -61 5.8 CAACGTTACCGGTAACATAT
VS_II0411 gntR -43 5.9 CTATGTTACCAGTAACATTA
Vibrio salmonicida LFI1238
VSAL_II0665 gntU -87 6.1 TTAAGTTACGGGTAACATGT
VSAL_II0665 gntU -73 5.7 ACATGTTACCCGTAACTCTT
VSAL_II0668 gntR -32 5.3 ACTTGTTACAAGTAACATTG
VSAL_II0666 gntK -92 6.1 ACATGTTACCCGTAACTTAA
VSAL_II0666 gntK -106 5.7 AAGAGTTACGGGTAACATGT
Vibrio angustum S14
VAS14_06893 gntU -107 6.3 CCATGTTACGGGTAACATGT
VAS14_06893 gntU -93 6.2 ACATGTTACCCGTAACATTG
VAS14_06898 gntK -75 6.3 ACATGTTACCCGTAACATGG
VAS14_06898 gntK -89 6.2 CAATGTTACGGGTAACATGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD