Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Desulfuromonadales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Desulfuromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Geobacter metallireducens GS-15
Gmet_2854 rpoH -64 7.3 TTAGCACTCAGACAAACCGAGTGCTAA
Gmet_0028 groS -81 7.4 TTAGCACTCAGCTGTATCGAGTGCTAA
Gmet_3534 hrcA -46 7.4 TTAGCACTCACCAACTCTGAGTGCTAA
Geobacter sulfurreducens PCA
GSU0655 rpoH -52 7.4 TTAGCACTCAGACGTACCGAGTGCTAA
GSU3339 groS -80 7.4 TTAGCACTCAGTCGTATCGAGTGCTAA
GSU0031 hrcA -48 7.4 TTAGCACTCACGTCCCTTGAGTGCTAA
Geobacter uraniumreducens Rf4
Gura_3950 rpoH -92 6.8 TTAGCACTCTTAACTTGAGAGTGCCAA
Gura_4306 groS -85 7.2 TTAGCACTCGGCAGCTTGGAGTGCTAA
Gura_0209 hrcA -47 7.4 TTAGCACTCGAATTCCTTGAGTGCTAA
Geobacter sp. FRC-32
Geob_0795 rpoH -58 7.2 TTAGCACTCGATTCTGAAGAGTGCTAA
Geob_1105 hrcA -49 7.5 TTAGCACTCAAATTCTTTGAGTGCTAA
Geob_0399 groS -81 7 TTAGCACTCAGCTACAAGGAGTGCTAA
Geobacter sp. M21
GM21_0586 rpoH -69 6.8 TTAGCGCTCACATGGGCAGAGTGCTAA
GM21_0232 groS -78 7.6 TTAGCACTCAGCAGTTTTGAGTGCTAA
GM21_3576 hrcA -47 7.4 TTAGCACTCGAACTTTTTGAGTGCTAA
Geobacter lovleyi SZ
Glov_0181 rpoH -56 7.1 TTAGCAGTCAGCACCATAGAGTGCTAA
Glov_1330 rpoH -51 6.9 TTAGCAGTCTTGTGTGTCGAGTGCTAA
Glov_2928 groS -79 6.9 TTAGCACTCACCGCTTTAGAGTGCTAG
Glov_2831 hrcA -79 7.4 TTAGCACTCAAGTTTATAGAGTGCTAA
Pelobacter propionicus DSM 2379
Ppro_0114 rpoH -56 6.9 TTAGCAGTCACCGCACGAGAGTGCTAA
Ppro_0664 rpoH -63 6.6 TTGGCAGTCGGACGGCTTGAGTGCTAA
Ppro_2803 groS -77 7.3 TTAGCACTCGGTCATCGTGAGTGCTAA
Ppro_1406 hrcA -44 6.8 TTAGCACTCTCCAGTCATGAGTGCTAT
Pelobacter carbinolicus str. DSM 2380
Pcar_0109 hrcA -42 7.4 TTAGCACTCAATAAGCTAGAGTGCTAA
Pcar_2382 rpoH -59 7.1 TTAGCACTCGCCATCAACGAGTGCTAA
Pcar_2771 groS -159 7.2 TTAGCACTCATGTAAACCGAGTGCTAA
Desulfuromonas acetoxidans DSM 684
Dace_0267 hrcA -86 7.2 TTAGCACTCCGGATGTTTGAGTGCTAA
Dace_1569 rpoH -63 7.3 TTAGCACTCAAGGCAAGAGAGTGCTAA
Dace_1149 groS -105 7.2 TTAGCACTCCCTTTTGCTGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD