Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Caulobacterales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter crescentus CB15
CC0686 groS -86 7.1 TTGGCACTCGAATGGAGCGACTGCTAA
Caulobacter segnis ATCC 21756
Cseg_3693 groS -87 7.3 TTAGCACTCGGAGGGAGCGACTGCTAA
Caulobacter sp. K31
Caul_4151 groS -88 7.4 TTGGCACTCGATGGGAGCGACTGCTAA
Phenylobacterium zucineum HLK1
PHZ_c3181 groS -93 6.9 TTAGCACTCAAGGGCCGAGACTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD