Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Sphingomonadales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Sphingomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Erythrobacter litoralis HTCC2594
ELI_14405 groS -64 7.2 CTGGCACTCTCTGGACGAGAGTGCCAA
Erythrobacter sp. NAP1
NAP1_11773 groS -63 7 CTGGCACTCTTATGCCAAGAGTGCCAA
Novosphingobium aromaticivorans DSM 12444
Saro_0034 groS -61 7.3 CTGGCACTCTCGGGTTGAGAGTGCCAA
Sphingopyxis alaskensis RB2256
Sala_0453 groS -59 7 TTAGCACTCTCCTGTGGCGAGTGCTAA
Sphingobium japonicum UT26S
SJA_C1-21260 groS -120 7 CTGGCACTCCCCGACGAGGAGTGCTAA
Sphingomonas wittichii RW1
Swit_3375 groS -100 6.4 CTGGCACTCGCTTCCGGTGAGTGCTAA
Zymomonas mobilis subsp. mobilis ZM4
ZMO1928 groS 10 6.5 TTGGCACTTCGCAAGGGAGAGTGCCAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD