Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Rhodospirillales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodospirillum rubrum ATCC 11170
Rru_A0586 groS -94 7.4 TTAGCACTCGCCGGGTGGGAGTGCTAA
Magnetospirillum magnetotacticum MS-1
Magn03009934 groS -73 7.3 TTGGCACTCGTCGCCGGAGAGTGCTAA
Magnetospirillum magneticum AMB-1
amb0203 groL -388 7.3 TTGGCACTCGTCGCCGGAGAGTGCTAA
Azospirillum sp. B510
AZL_003450 groS -90 7.2 CTGGCACTCGCCGGGCGGGAGTGCTAA
Rhodospirillum centenum SW
RC1_2594 groS -73 7.3 CTGGCACTCACCGCGGGTGAGTGCTAA
Gluconacetobacter diazotrophicus PAl 5
Gdia_0272 groS -109 7.3 CTGGCACTCTCGTGCGGAGAGTGCCAA
Acetobacter pasteurianus IFO 3283-01
APA01_17860 groS -41 7.2 CTGGCACTCCCGGGGTGGGAGTGCTAA
Gluconobacter oxydans 621H
GOX1901 groS -92 7.1 TTGGCACTCTCCATGTGAGAGTGCCAA
Granulibacter bethesdensis CGDNIH1
GbCGDNIH1_2181 groS -69 7.3 CTGGCACTCCCCGCATGGGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD