Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Rhodobacterales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodobacter sphaeroides 2.4.1
RSP_2310 groS -62 7.5 TTGGCACTCGCCTCGGGTGAGTGCTAA
Paracoccus denitrificans PD1222
Pden_3654 groL -396 7.2 TTGGCACTCACCCGAGCCGAGTGCCAA
Jannaschia sp. CCS1
Jann_3359 groS -72 6.9 TTGGCACTCGCGTTCGGTGAGTGCTAA
Rhodobacterales bacterium HTCC2654
RB2654_08122 groS -86 7.4 TTAGCACTCACCCCCGGTGAGTGCCAA
Oceanicola granulosus HTCC2516
OG2516_17151 groS -54 7.5 TTAGCACTCACACCGAGCGAGTGCTAA
Loktanella vestfoldensis SKA53
SKA53_08661 groS -60 7.1 TTGGCACTCGGACTGGCTGAGTGCTAA
Oceanicola batsensis HTCC2597
OB2597_07485 groS -94 7.1 TTAGCACTCGCGTGGTGTGAGTGATAA
Roseovarius nubinhibens ISM
ISM_05760 groS -79 7.2 TTAGCACTCGGAGGGACTGAGTGCTAA
Roseovarius sp. 217
ROS217_12501 groS -81 7 TTAGCACTCGAACCCCATGAGTGCTAA
Sulfitobacter sp. EE-36
EE36_03888 groS -92 7.6 TTAGCACTCGGCAGGGCTGAGTGCTAA
Silicibacter TM1040
TM1040_0596 groS -94 7.5 TTAGCACTCGACTGAGGTGAGTGCTAA
Silicibacter pomeroyi DSS-3
SPO0886 groS -86 7.2 TTAGCACTCGTCAGACCTGAGTGCTAA
Roseobacter sp. MED193
MED193_20209 groS -93 7.1 TTAGCACTCATCAGGTGTGAGTGATAA
Hyphomonas neptunium ATCC 15444
HNE_1961 groS -110 7.4 TTAGCAGTCGGCTCGGGCGAGTGCTAA
Oceanicaulis alexandrii HTCC2633
OA2633_05922 groS -94 6.4 TTAGCAGCCAGGGCAGGAGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD