Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Rhizobiales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Sinorhizobium meliloti 1021
SMc00912 groS -85 6.7 CTAGCACTCGCTTGATATGAGTGCTAA
SMa0745 groS -83 6.9 CTAGCACTCTCGCGTGAAGAGTGCTAA
Rhizobium sp. NGR234
NGR_c04090 groS -85 6.8 CTAGCACTCTTTAAGAAGGAGTGCTAA
NGR_b05110 groS -175 6.8 TTAGCACTCCATGTGATGGAGTGCTAA
NGR_b05810 groS -178 6.8 GTAGCACTCTCAAGTGGCGAGTGCTAA
Rhizobium leguminosarum bv. viciae 3841
RL0884 groS -85 6.9 CTAGCACTCACCGCAAGGGAGTGCTAA
RL1410 groS -81 6.1 TTGGCACTCCTATCAATCGAGTGCCAC
pRL120643 groS -172 6.8 CTAGCACTCGCGGGCAGGGAGTGCCAA
Rhizobium etli CFN 42
RHE_CH00829 groS -85 6.9 CTAGCACTCACCGCAAGGGAGTGCTAA
RHE_CH01270 groS -81 6.1 TTGGCACTCCTATCAATCGAGTGCCAC
RHE_PF00329 groS -169 6.8 TTAGCAGTCGTCGATAGAGAGTGCTAA
RHE_CH01238 groS -177 6 TTAGCAGCCACTTCGAGTGAGTGCTAA
Agrobacterium tumefaciens str. C58 (Cereon)
Atu0683 groS -85 6.6 CTGGCACTCCAACAAGGGGAGTGCTAA
Mesorhizobium sp. BNC1
Meso_0358 groS -94 7.2 TTAGCACTCTCCTACAGCGAGTGCTAA
Meso_3096 groS -167 6.9 TTGGCACTCTCAATAGGTGAGTGCTAA
Mesorhizobium loti MAFF303099
mll8202 groS -91 7.2 TTAGCACTCGCCCTTGGTGAGTGCTAA
msl5812 groS -79 7.2 TTAGCACTCCCCAATAGCGAGTGCTAA
msr9341 groS -81 7.1 TTAGCACTCGCCTCTGCCGAGTGCTAA
mlr2393 groS -183 6.7 CTAGCACTCTCGCACGCCGAGTGCCAA
mll2233 groS -80 6.5 TTGGCACTCCTATCTATCGAGTGCCAA
Brucella melitensis 16M
BMEII1047 groS -87 6.7 TTAGCACTCGGACGAATAGAGTGCTAA
Bartonella quintana str. Toulouse
BQ10760 groS -76 6.9 TTAGCACTCTCCAACTATGAGTGCTAA
Rhodopseudomonas palustris CGA009
RPA1141 groS -109 6.5 TTAGCACTCTTGCAGTACGACTGCCAA
RPA2165 groS -69 6.2 CTGGCACTCTTCGCCCGCGACTGCCAA
Bradyrhizobium japonicum USDA 110
bsr7532 groS -119 6.5 TTAGCACTCGGAAAGCCCGATTGCTAA
blr5625 groS -70 6.4 CTAGCACTCGCGGGCACAGACTGCTAA
blr6978 groS -59 5.5 TCAGCACTCGCTAGCTTCGACTGCTAT
blr5226 groS -137 5.4 TTGGCAGTCAGACGGCCGGAGTGACAA
Bradyrhizobium sp. BTAi1
BBta_1672 groS -126 6.5 TTAGCACTCGGAGGGCACGATTGCTAA
BBta_5284 groS -71 6.4 CTGGCACTCGCCGGCAGCGACTGCCAA
BBta_3033 groS -143 6.1 CTGGCAATCGTTCCCACCGAGTGCCAA
Nitrobacter winogradskyi Nb-255
Nwi_2114 groS -144 5.8 TTGGCGCTCCAGGGCGCGGAGTGCCAA
Nwi_2573 groS -117 6 GTGGCACTCTCGCAATACGATTGCCAA
Nwi_2191 groS -70 5.8 CTGGCACTCGCTGGTATTGACTGCCAG
Azorhizobium caulinodans ORS 571
AZC_2311 groS -184 6.7 TTGGCACTCATGGGAGAGGAGTGCTAA
AZC_0425 groS -71 6.5 TTGGCACTCCCATCCGGTGAGTGCCAG
Xanthobacter autotrophicus Py2
Xaut_4265 groS -138 6.8 CTAGCACTCCACATCCGCGAGTGCTAA
Xaut_1165 groS -71 6.6 TTGGCACTCCACCTTGGAGAGTGCCAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD